ID: 1197392301

View in Genome Browser
Species Human (GRCh38)
Location X:125882938-125882960
Sequence CCAAAATGCAGACAGTAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197392299_1197392301 3 Left 1197392299 X:125882912-125882934 CCTAGAGACTTGTTGAATGGTTC 0: 9
1: 433
2: 2088
3: 2045
4: 1288
Right 1197392301 X:125882938-125882960 CCAAAATGCAGACAGTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197392301 Original CRISPR CCAAAATGCAGACAGTAATA TGG Intergenic
No off target data available for this crispr