ID: 1197392351

View in Genome Browser
Species Human (GRCh38)
Location X:125883377-125883399
Sequence TGCACAAGGGAGTGGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197392351_1197392363 19 Left 1197392351 X:125883377-125883399 CCAGGGCCCCACTCCCTTGTGCA No data
Right 1197392363 X:125883419-125883441 ACTCCAGCCATGGCTAAAATGGG No data
1197392351_1197392362 18 Left 1197392351 X:125883377-125883399 CCAGGGCCCCACTCCCTTGTGCA No data
Right 1197392362 X:125883418-125883440 CACTCCAGCCATGGCTAAAATGG No data
1197392351_1197392359 9 Left 1197392351 X:125883377-125883399 CCAGGGCCCCACTCCCTTGTGCA No data
Right 1197392359 X:125883409-125883431 CTTTGTGCCCACTCCAGCCATGG No data
1197392351_1197392365 25 Left 1197392351 X:125883377-125883399 CCAGGGCCCCACTCCCTTGTGCA No data
Right 1197392365 X:125883425-125883447 GCCATGGCTAAAATGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197392351 Original CRISPR TGCACAAGGGAGTGGGGCCC TGG (reversed) Intergenic