ID: 1197392354

View in Genome Browser
Species Human (GRCh38)
Location X:125883385-125883407
Sequence CCTGAGGCTGCACAAGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 928
Summary {0: 1, 1: 4, 2: 17, 3: 195, 4: 711}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197392354_1197392359 1 Left 1197392354 X:125883385-125883407 CCACTCCCTTGTGCAGCCTCAGG 0: 1
1: 4
2: 17
3: 195
4: 711
Right 1197392359 X:125883409-125883431 CTTTGTGCCCACTCCAGCCATGG No data
1197392354_1197392363 11 Left 1197392354 X:125883385-125883407 CCACTCCCTTGTGCAGCCTCAGG 0: 1
1: 4
2: 17
3: 195
4: 711
Right 1197392363 X:125883419-125883441 ACTCCAGCCATGGCTAAAATGGG 0: 7
1: 110
2: 692
3: 1206
4: 1580
1197392354_1197392365 17 Left 1197392354 X:125883385-125883407 CCACTCCCTTGTGCAGCCTCAGG 0: 1
1: 4
2: 17
3: 195
4: 711
Right 1197392365 X:125883425-125883447 GCCATGGCTAAAATGGGACAAGG 0: 2
1: 32
2: 336
3: 635
4: 939
1197392354_1197392362 10 Left 1197392354 X:125883385-125883407 CCACTCCCTTGTGCAGCCTCAGG 0: 1
1: 4
2: 17
3: 195
4: 711
Right 1197392362 X:125883418-125883440 CACTCCAGCCATGGCTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197392354 Original CRISPR CCTGAGGCTGCACAAGGGAG TGG (reversed) Intergenic