ID: 1197392356

View in Genome Browser
Species Human (GRCh38)
Location X:125883390-125883412
Sequence AAAGTCCTGAGGCTGCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197392356_1197392363 6 Left 1197392356 X:125883390-125883412 CCCTTGTGCAGCCTCAGGACTTT No data
Right 1197392363 X:125883419-125883441 ACTCCAGCCATGGCTAAAATGGG No data
1197392356_1197392359 -4 Left 1197392356 X:125883390-125883412 CCCTTGTGCAGCCTCAGGACTTT No data
Right 1197392359 X:125883409-125883431 CTTTGTGCCCACTCCAGCCATGG No data
1197392356_1197392365 12 Left 1197392356 X:125883390-125883412 CCCTTGTGCAGCCTCAGGACTTT No data
Right 1197392365 X:125883425-125883447 GCCATGGCTAAAATGGGACAAGG No data
1197392356_1197392362 5 Left 1197392356 X:125883390-125883412 CCCTTGTGCAGCCTCAGGACTTT No data
Right 1197392362 X:125883418-125883440 CACTCCAGCCATGGCTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197392356 Original CRISPR AAAGTCCTGAGGCTGCACAA GGG (reversed) Intergenic