ID: 1197392358

View in Genome Browser
Species Human (GRCh38)
Location X:125883401-125883423
Sequence GGAGTGGGCACAAAGTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197392358_1197392362 -6 Left 1197392358 X:125883401-125883423 CCTCAGGACTTTGTGCCCACTCC No data
Right 1197392362 X:125883418-125883440 CACTCCAGCCATGGCTAAAATGG No data
1197392358_1197392365 1 Left 1197392358 X:125883401-125883423 CCTCAGGACTTTGTGCCCACTCC No data
Right 1197392365 X:125883425-125883447 GCCATGGCTAAAATGGGACAAGG No data
1197392358_1197392363 -5 Left 1197392358 X:125883401-125883423 CCTCAGGACTTTGTGCCCACTCC No data
Right 1197392363 X:125883419-125883441 ACTCCAGCCATGGCTAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197392358 Original CRISPR GGAGTGGGCACAAAGTCCTG AGG (reversed) Intergenic