ID: 1197392359

View in Genome Browser
Species Human (GRCh38)
Location X:125883409-125883431
Sequence CTTTGTGCCCACTCCAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197392352_1197392359 3 Left 1197392352 X:125883383-125883405 CCCCACTCCCTTGTGCAGCCTCA No data
Right 1197392359 X:125883409-125883431 CTTTGTGCCCACTCCAGCCATGG No data
1197392354_1197392359 1 Left 1197392354 X:125883385-125883407 CCACTCCCTTGTGCAGCCTCAGG No data
Right 1197392359 X:125883409-125883431 CTTTGTGCCCACTCCAGCCATGG No data
1197392353_1197392359 2 Left 1197392353 X:125883384-125883406 CCCACTCCCTTGTGCAGCCTCAG No data
Right 1197392359 X:125883409-125883431 CTTTGTGCCCACTCCAGCCATGG No data
1197392351_1197392359 9 Left 1197392351 X:125883377-125883399 CCAGGGCCCCACTCCCTTGTGCA No data
Right 1197392359 X:125883409-125883431 CTTTGTGCCCACTCCAGCCATGG No data
1197392357_1197392359 -5 Left 1197392357 X:125883391-125883413 CCTTGTGCAGCCTCAGGACTTTG No data
Right 1197392359 X:125883409-125883431 CTTTGTGCCCACTCCAGCCATGG No data
1197392356_1197392359 -4 Left 1197392356 X:125883390-125883412 CCCTTGTGCAGCCTCAGGACTTT No data
Right 1197392359 X:125883409-125883431 CTTTGTGCCCACTCCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197392359 Original CRISPR CTTTGTGCCCACTCCAGCCA TGG Intergenic