ID: 1197392363

View in Genome Browser
Species Human (GRCh38)
Location X:125883419-125883441
Sequence ACTCCAGCCATGGCTAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197392353_1197392363 12 Left 1197392353 X:125883384-125883406 CCCACTCCCTTGTGCAGCCTCAG No data
Right 1197392363 X:125883419-125883441 ACTCCAGCCATGGCTAAAATGGG No data
1197392354_1197392363 11 Left 1197392354 X:125883385-125883407 CCACTCCCTTGTGCAGCCTCAGG No data
Right 1197392363 X:125883419-125883441 ACTCCAGCCATGGCTAAAATGGG No data
1197392356_1197392363 6 Left 1197392356 X:125883390-125883412 CCCTTGTGCAGCCTCAGGACTTT No data
Right 1197392363 X:125883419-125883441 ACTCCAGCCATGGCTAAAATGGG No data
1197392358_1197392363 -5 Left 1197392358 X:125883401-125883423 CCTCAGGACTTTGTGCCCACTCC No data
Right 1197392363 X:125883419-125883441 ACTCCAGCCATGGCTAAAATGGG No data
1197392352_1197392363 13 Left 1197392352 X:125883383-125883405 CCCCACTCCCTTGTGCAGCCTCA No data
Right 1197392363 X:125883419-125883441 ACTCCAGCCATGGCTAAAATGGG No data
1197392351_1197392363 19 Left 1197392351 X:125883377-125883399 CCAGGGCCCCACTCCCTTGTGCA No data
Right 1197392363 X:125883419-125883441 ACTCCAGCCATGGCTAAAATGGG No data
1197392357_1197392363 5 Left 1197392357 X:125883391-125883413 CCTTGTGCAGCCTCAGGACTTTG No data
Right 1197392363 X:125883419-125883441 ACTCCAGCCATGGCTAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197392363 Original CRISPR ACTCCAGCCATGGCTAAAAT GGG Intergenic