ID: 1197392365

View in Genome Browser
Species Human (GRCh38)
Location X:125883425-125883447
Sequence GCCATGGCTAAAATGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1944
Summary {0: 2, 1: 32, 2: 336, 3: 635, 4: 939}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197392357_1197392365 11 Left 1197392357 X:125883391-125883413 CCTTGTGCAGCCTCAGGACTTTG No data
Right 1197392365 X:125883425-125883447 GCCATGGCTAAAATGGGACAAGG 0: 2
1: 32
2: 336
3: 635
4: 939
1197392358_1197392365 1 Left 1197392358 X:125883401-125883423 CCTCAGGACTTTGTGCCCACTCC No data
Right 1197392365 X:125883425-125883447 GCCATGGCTAAAATGGGACAAGG 0: 2
1: 32
2: 336
3: 635
4: 939
1197392353_1197392365 18 Left 1197392353 X:125883384-125883406 CCCACTCCCTTGTGCAGCCTCAG No data
Right 1197392365 X:125883425-125883447 GCCATGGCTAAAATGGGACAAGG 0: 2
1: 32
2: 336
3: 635
4: 939
1197392352_1197392365 19 Left 1197392352 X:125883383-125883405 CCCCACTCCCTTGTGCAGCCTCA No data
Right 1197392365 X:125883425-125883447 GCCATGGCTAAAATGGGACAAGG 0: 2
1: 32
2: 336
3: 635
4: 939
1197392354_1197392365 17 Left 1197392354 X:125883385-125883407 CCACTCCCTTGTGCAGCCTCAGG 0: 1
1: 4
2: 17
3: 195
4: 711
Right 1197392365 X:125883425-125883447 GCCATGGCTAAAATGGGACAAGG 0: 2
1: 32
2: 336
3: 635
4: 939
1197392356_1197392365 12 Left 1197392356 X:125883390-125883412 CCCTTGTGCAGCCTCAGGACTTT No data
Right 1197392365 X:125883425-125883447 GCCATGGCTAAAATGGGACAAGG 0: 2
1: 32
2: 336
3: 635
4: 939
1197392351_1197392365 25 Left 1197392351 X:125883377-125883399 CCAGGGCCCCACTCCCTTGTGCA No data
Right 1197392365 X:125883425-125883447 GCCATGGCTAAAATGGGACAAGG 0: 2
1: 32
2: 336
3: 635
4: 939

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197392365 Original CRISPR GCCATGGCTAAAATGGGACA AGG Intergenic