ID: 1197397856

View in Genome Browser
Species Human (GRCh38)
Location X:125949478-125949500
Sequence CCGAATATACAGATAATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197397856_1197397863 24 Left 1197397856 X:125949478-125949500 CCATTGATTATCTGTATATTCGG No data
Right 1197397863 X:125949525-125949547 GTGCTGAATGTAGCTGGTGATGG No data
1197397856_1197397862 18 Left 1197397856 X:125949478-125949500 CCATTGATTATCTGTATATTCGG No data
Right 1197397862 X:125949519-125949541 CCTCAAGTGCTGAATGTAGCTGG No data
1197397856_1197397864 25 Left 1197397856 X:125949478-125949500 CCATTGATTATCTGTATATTCGG No data
Right 1197397864 X:125949526-125949548 TGCTGAATGTAGCTGGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197397856 Original CRISPR CCGAATATACAGATAATCAA TGG (reversed) Intergenic
No off target data available for this crispr