ID: 1197399871

View in Genome Browser
Species Human (GRCh38)
Location X:125977356-125977378
Sequence AGGGAAAGCAAAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197399863_1197399871 16 Left 1197399863 X:125977317-125977339 CCATGTGGTGTGGTGAGAGAGAA No data
Right 1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG No data
1197399862_1197399871 25 Left 1197399862 X:125977308-125977330 CCTATAGTGCCATGTGGTGTGGT No data
Right 1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG No data
1197399860_1197399871 26 Left 1197399860 X:125977307-125977329 CCCTATAGTGCCATGTGGTGTGG No data
Right 1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197399871 Original CRISPR AGGGAAAGCAAAGTGATTGT GGG Intergenic
No off target data available for this crispr