ID: 1197400795

View in Genome Browser
Species Human (GRCh38)
Location X:125987868-125987890
Sequence TGGAAGAGACCACAATACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197400795_1197400797 10 Left 1197400795 X:125987868-125987890 CCACTGTATTGTGGTCTCTTCCA No data
Right 1197400797 X:125987901-125987923 GATTTATTTACCATATTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197400795 Original CRISPR TGGAAGAGACCACAATACAG TGG (reversed) Intergenic
No off target data available for this crispr