ID: 1197400797 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:125987901-125987923 |
| Sequence | GATTTATTTACCATATTACT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197400795_1197400797 | 10 | Left | 1197400795 | X:125987868-125987890 | CCACTGTATTGTGGTCTCTTCCA | No data | ||
| Right | 1197400797 | X:125987901-125987923 | GATTTATTTACCATATTACTTGG | No data | ||||
| 1197400796_1197400797 | -10 | Left | 1197400796 | X:125987888-125987910 | CCAGAATATTAATGATTTATTTA | No data | ||
| Right | 1197400797 | X:125987901-125987923 | GATTTATTTACCATATTACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197400797 | Original CRISPR | GATTTATTTACCATATTACT TGG | Intergenic | ||