ID: 1197405526

View in Genome Browser
Species Human (GRCh38)
Location X:126043358-126043380
Sequence GAGTCTCTTTTAACCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197405526_1197405528 -9 Left 1197405526 X:126043358-126043380 CCTGGGGTGGTTAAAAGAGACTC No data
Right 1197405528 X:126043372-126043394 AAGAGACTCTTCTTTTTGTTGGG No data
1197405526_1197405527 -10 Left 1197405526 X:126043358-126043380 CCTGGGGTGGTTAAAAGAGACTC No data
Right 1197405527 X:126043371-126043393 AAAGAGACTCTTCTTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197405526 Original CRISPR GAGTCTCTTTTAACCACCCC AGG (reversed) Intergenic
No off target data available for this crispr