ID: 1197405528

View in Genome Browser
Species Human (GRCh38)
Location X:126043372-126043394
Sequence AAGAGACTCTTCTTTTTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197405520_1197405528 14 Left 1197405520 X:126043335-126043357 CCCTCGAATGCATGCAATGAAAG No data
Right 1197405528 X:126043372-126043394 AAGAGACTCTTCTTTTTGTTGGG No data
1197405521_1197405528 13 Left 1197405521 X:126043336-126043358 CCTCGAATGCATGCAATGAAAGC No data
Right 1197405528 X:126043372-126043394 AAGAGACTCTTCTTTTTGTTGGG No data
1197405526_1197405528 -9 Left 1197405526 X:126043358-126043380 CCTGGGGTGGTTAAAAGAGACTC No data
Right 1197405528 X:126043372-126043394 AAGAGACTCTTCTTTTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197405528 Original CRISPR AAGAGACTCTTCTTTTTGTT GGG Intergenic