ID: 1197409326

View in Genome Browser
Species Human (GRCh38)
Location X:126096447-126096469
Sequence AGTTATATGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197409323_1197409326 22 Left 1197409323 X:126096402-126096424 CCAAAGCTCAGTAACAGGCAATG No data
Right 1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG No data
1197409322_1197409326 25 Left 1197409322 X:126096399-126096421 CCACCAAAGCTCAGTAACAGGCA No data
Right 1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197409326 Original CRISPR AGTTATATGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr