ID: 1197413984

View in Genome Browser
Species Human (GRCh38)
Location X:126151507-126151529
Sequence ATGGATTAGCACCATCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2431
Summary {0: 2, 1: 103, 2: 371, 3: 800, 4: 1155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197413984_1197413992 20 Left 1197413984 X:126151507-126151529 CCAAGAGGATGGTGCTAATCCAT 0: 2
1: 103
2: 371
3: 800
4: 1155
Right 1197413992 X:126151550-126151572 TGATCCAATCACCTCTCTCCAGG 0: 4
1: 179
2: 2433
3: 4994
4: 8527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197413984 Original CRISPR ATGGATTAGCACCATCCTCT TGG (reversed) Intergenic
Too many off-targets to display for this crispr