ID: 1197414995

View in Genome Browser
Species Human (GRCh38)
Location X:126164739-126164761
Sequence TTCCAGCCTGGACTCCATGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 256}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197414995_1197415002 5 Left 1197414995 X:126164739-126164761 CCGGCATGGAGTCCAGGCTGGAA 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1197415002 X:126164767-126164789 CCTCTCCTCCAGGAACTTCTGGG 0: 1
1: 0
2: 4
3: 36
4: 316
1197414995_1197415004 10 Left 1197414995 X:126164739-126164761 CCGGCATGGAGTCCAGGCTGGAA 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1197415004 X:126164772-126164794 CCTCCAGGAACTTCTGGGCGCGG 0: 1
1: 0
2: 1
3: 22
4: 187
1197414995_1197414998 -5 Left 1197414995 X:126164739-126164761 CCGGCATGGAGTCCAGGCTGGAA 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1197414998 X:126164757-126164779 TGGAAGAGGCCCTCTCCTCCAGG 0: 1
1: 0
2: 1
3: 23
4: 209
1197414995_1197415006 28 Left 1197414995 X:126164739-126164761 CCGGCATGGAGTCCAGGCTGGAA 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1197415006 X:126164790-126164812 CGCGGATGTCATAGAAGAGCAGG 0: 1
1: 0
2: 2
3: 2
4: 45
1197414995_1197415000 4 Left 1197414995 X:126164739-126164761 CCGGCATGGAGTCCAGGCTGGAA 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1197415000 X:126164766-126164788 CCCTCTCCTCCAGGAACTTCTGG 0: 1
1: 0
2: 3
3: 26
4: 337
1197414995_1197415007 29 Left 1197414995 X:126164739-126164761 CCGGCATGGAGTCCAGGCTGGAA 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1197415007 X:126164791-126164813 GCGGATGTCATAGAAGAGCAGGG 0: 1
1: 0
2: 2
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197414995 Original CRISPR TTCCAGCCTGGACTCCATGC CGG (reversed) Exonic
901001733 1:6152170-6152192 TTCTAGCCTGGACTCTGGGCAGG - Intronic
901108676 1:6777984-6778006 CTCCAGCCTGCACTCCAGCCTGG - Intergenic
901674600 1:10875530-10875552 GCCCAGCCCAGACTCCATGCAGG - Intergenic
901680535 1:10910271-10910293 TCCCAGCCTGGAGGCCATCCTGG + Intergenic
901701217 1:11045589-11045611 ATCCAGCCTGGACTCCTCCCAGG + Intronic
901930631 1:12594708-12594730 TTCCACACTGGTCTCCGTGCTGG - Intronic
902341204 1:15784762-15784784 TTGCAGGCTGGTCTCCATGGAGG - Intronic
902839844 1:19067830-19067852 GTCCAGCCAGGACTCCTTGTCGG + Intergenic
907371855 1:54008945-54008967 TTCCAGCCAGCCTTCCATGCTGG + Exonic
908870318 1:68603142-68603164 TTCCAACCTGGACTACATAATGG - Intergenic
912239958 1:107896001-107896023 TTTCAGCTTGGACTTCTTGCAGG + Intronic
913648276 1:120883623-120883645 CTCCAGCCTGGGCTCCAGCCTGG - Intergenic
914173325 1:145248202-145248224 CTCCAGCCTGGGCTCCAGCCTGG + Intergenic
914298220 1:146350802-146350824 CTCCAGCCTGGGCTCCAGCCTGG + Intergenic
914527979 1:148489339-148489361 CTCCAGCCTGGGCTCCAGCCTGG + Intergenic
914638409 1:149577727-149577749 CTCCAGCCTGGGCTCCAGCCTGG - Intergenic
914763849 1:150621028-150621050 TTGCACCCTGCACTCCATTCTGG + Intronic
915469900 1:156119657-156119679 TGCAAGCCTGGACTCCAGACAGG - Intronic
916607916 1:166361281-166361303 GTCCAGCCTGCATTTCATGCTGG + Intergenic
917101021 1:171445390-171445412 CTCCAGCCTGCACTCCAGCCTGG + Intergenic
917753557 1:178076791-178076813 TTTCAGCCTGGACTTCAGCCTGG - Intergenic
918041591 1:180917062-180917084 CCCCTGCCTGGACTCCATCCTGG + Exonic
919687954 1:200501974-200501996 CTCCAGCCTGCACTCCAGCCTGG - Intergenic
921010250 1:211134018-211134040 TTCGAGCCGGGACTGCGTGCGGG - Intronic
921709935 1:218363916-218363938 GGCCATCCTGGACTGCATGCAGG - Intronic
922352151 1:224742964-224742986 TCCCAGCCTGACCTCCATTCAGG - Intergenic
924727339 1:246682886-246682908 TTACAGGGTGGACCCCATGCTGG + Intergenic
1063506326 10:6603491-6603513 TTCCAGCCTCTACTCCAAGAAGG - Intergenic
1064055276 10:12092017-12092039 TTCCAGCTTGTACTCCATGCTGG + Intronic
1067232202 10:44419762-44419784 TTCCAGCCTGGACCTCTGGCTGG + Intergenic
1067464482 10:46487149-46487171 TACAAGGCTGGACTACATGCAGG - Intergenic
1067622714 10:47897508-47897530 TACAAGGCTGGACTACATGCAGG + Intergenic
1068949118 10:62759899-62759921 TTCCAGCCAGGCCTCCCTGTTGG - Intergenic
1069160379 10:65084769-65084791 TTCCAGCCTCCACTCAATGGTGG - Intergenic
1070058616 10:72958957-72958979 CTCCAGCCTGCACTCCAGCCTGG - Intergenic
1070228800 10:74541747-74541769 TGCCACCCTGGACTCCAGCCTGG + Intronic
1072779549 10:98237834-98237856 TTAAAGCCTGGGCTCCATGCAGG - Intronic
1073182466 10:101593130-101593152 ATCCTGCCTGGACTCAAGGCTGG + Intronic
1073182467 10:101593132-101593154 ATCCAGCCTTGAGTCCAGGCAGG - Intronic
1074215641 10:111381382-111381404 CTCCAGCCTGGATCCCATGCTGG + Intergenic
1074626008 10:115187499-115187521 TCCCAGACTGGATTCTATGCTGG + Intronic
1076871286 10:133196257-133196279 TCCCTGCCTGGTCTCCCTGCTGG + Intronic
1077217481 11:1400974-1400996 TCCCAGCCTGGCCTCAATGCGGG + Intronic
1077266706 11:1654526-1654548 CCACAGGCTGGACTCCATGCTGG - Intergenic
1077533600 11:3108447-3108469 TGCCAGCCTGGAGTCCAGGGAGG + Intronic
1077533601 11:3108449-3108471 CTCCTCCCTGGACTCCAGGCTGG - Intronic
1079580545 11:22057551-22057573 TACCACCCTGGTCTCCATGATGG - Intergenic
1079845878 11:25466921-25466943 CTCCAGCCTGGAGTGCAGGCTGG + Intergenic
1079845879 11:25466923-25466945 CTCCAGCCTGCACTCCAGGCTGG - Intergenic
1080222000 11:29916841-29916863 TTCCAGTCTGCACTGCATTCAGG + Intergenic
1081333591 11:41835227-41835249 TTCCAGTCTGAATTCCAGGCAGG - Intergenic
1081730621 11:45369494-45369516 TTCCAGCCTGAACCCAATGGGGG + Intergenic
1082866678 11:57906428-57906450 TAACAGCCTGGACTCCTTGGAGG - Intergenic
1083479823 11:62936664-62936686 TTTCAGCCTTGACTCCATCAGGG + Intronic
1084500083 11:69530246-69530268 TTCCAGCCTGACCTCCCTCCTGG - Intergenic
1085051079 11:73380598-73380620 CCCCAGCCTGGTCTCCAGGCAGG + Intronic
1087482373 11:98717945-98717967 TTGCAGCTTGAACGCCATGCTGG + Intergenic
1089412796 11:118260947-118260969 TCCCAGCCTTGACTCCATGAAGG + Intronic
1089773724 11:120821408-120821430 TTGGAGCCTAGAGTCCATGCTGG + Intronic
1092713579 12:11364735-11364757 CTGCAGCCTGGGCTCCAGGCTGG - Intronic
1097811528 12:64024397-64024419 CTCCAGCCTGGACTCCAGCCTGG + Intronic
1101240592 12:102834388-102834410 TTCCAGGCTGCATTCCATGCGGG + Intergenic
1101986364 12:109450580-109450602 TCCCAGCCTGGCATCCAGGCAGG - Exonic
1103486245 12:121284691-121284713 GTCCAGCCTGGACTTTATTCAGG - Intronic
1104460982 12:128955716-128955738 TTCCAGCTGGGACTCCACGCAGG + Intronic
1104618757 12:130293497-130293519 TTCCCGCCTGGAATAGATGCAGG + Intergenic
1105517472 13:21103512-21103534 CTCCAGCCTGCACTCCAACCTGG + Intergenic
1107629805 13:42331976-42331998 TTCCAGCCTGGACGACAAGAGGG - Intergenic
1108259786 13:48645070-48645092 GGCCAGCCTGAGCTCCATGCTGG - Intergenic
1108570089 13:51741162-51741184 TATCAGCATGGACTCCAAGCAGG - Intronic
1110417699 13:75270168-75270190 TTCCAGCCTGGACAACAAGAGGG - Intergenic
1111089992 13:83432759-83432781 TTCCAGCCTGGACAACAAGAGGG + Intergenic
1113052606 13:106230460-106230482 TGCCCTCCTGGACTTCATGCAGG - Intergenic
1113617439 13:111691093-111691115 ATCCAGCCTGCACTCCACGGCGG - Intergenic
1113622969 13:111776353-111776375 ATCCAGCCTGCACTCCACGGCGG - Intergenic
1115428734 14:33291334-33291356 TCTCAGCCTGGACTTCATGTAGG + Intronic
1115585420 14:34806954-34806976 TCCCAGGCTGGTCTCCAGGCTGG + Intronic
1115800757 14:36990859-36990881 CTCCAGCCTGAACTCCAGCCTGG + Intronic
1118318460 14:64739503-64739525 CTACAGCCTGGACCCCATGTTGG + Intronic
1119162221 14:72462192-72462214 TCCCAGCCTGGAATGCTTGCGGG - Intronic
1119719566 14:76881996-76882018 TTCCAGCCTAGACTGGGTGCAGG + Intergenic
1121029338 14:90645004-90645026 TGACACCCTGGATTCCATGCAGG + Intronic
1121063151 14:90936237-90936259 TTGCAGCCTAGACTACATACAGG - Intronic
1121455969 14:94039037-94039059 TTCCTACCTGGAGTCCCTGCTGG + Exonic
1123102169 14:105811602-105811624 TCCGAGCCTGGACTCCACACTGG + Intergenic
1123659380 15:22552339-22552361 CTCCAGCCTGGGCTCCAGCCTGG + Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1124264971 15:28224251-28224273 CTCCAGCCTGGGCTCCAGCCTGG - Intronic
1124313244 15:28646830-28646852 CTCCAGCCTGGGCTCCAGCCTGG + Intergenic
1127871634 15:63079032-63079054 CTCCGGCCTGGACTCCAGCCTGG + Intergenic
1127871635 15:63079034-63079056 CTCCAGGCTGGAGTCCAGGCCGG - Intergenic
1128174897 15:65546636-65546658 GACCAGCCTGGACTCCAGCCTGG - Intronic
1128269419 15:66294876-66294898 TTCCAGTCTTAACTCCATGGTGG - Intronic
1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG + Intronic
1130385050 15:83403746-83403768 CTCCAGCCTGCACTCCAGCCCGG + Intergenic
1131109925 15:89758687-89758709 GTCCAGCCTGCCCCCCATGCTGG - Intergenic
1133267392 16:4593350-4593372 CTCCAGAGTGGCCTCCATGCGGG - Intronic
1133949768 16:10381201-10381223 TTCCAGGCTGCACTCCAGCCTGG - Intronic
1135189908 16:20346306-20346328 TTCCAGCCTGTGCTCCAGGAGGG + Exonic
1135593358 16:23721436-23721458 TTCCAGCCTCCACTCCAGGGAGG + Intergenic
1137588003 16:49675706-49675728 CTCCAGCCTGGGATCGATGCAGG + Intronic
1137691370 16:50430340-50430362 CTCCACCCTGGACTCCCTCCTGG + Intergenic
1139558483 16:67727522-67727544 TTCCAGGCTGGGCATCATGCAGG - Intronic
1140623940 16:76769778-76769800 TTCAAGCCATGCCTCCATGCTGG - Intergenic
1141552091 16:84813055-84813077 CTCCAGCCTCGCCTCCATCCTGG + Intergenic
1143001922 17:3800071-3800093 ATCCAGCCTGGGCTCCAGCCTGG + Intronic
1143140277 17:4738686-4738708 GTCCAGCCTGAACTCCTTCCCGG - Intronic
1144095350 17:11895285-11895307 TCCAGGCCTGCACTCCATGCAGG + Intronic
1144101862 17:11948704-11948726 TTCCAGGCTGGCCTCCAGGCTGG - Intronic
1144129493 17:12232376-12232398 TTCCAGCCTACAGTCCTTGCTGG + Intergenic
1147139995 17:38455465-38455487 TCCTACCCTGGATTCCATGCAGG + Intronic
1147944183 17:44070961-44070983 GCCCAGCGTGGACTCCATGGCGG - Exonic
1149798699 17:59545905-59545927 ATCCAGCCTGCACTCCAGCCTGG + Intergenic
1151055318 17:71023900-71023922 TTTAAGCCAGGACTCCCTGCTGG - Intergenic
1151881961 17:76901248-76901270 TTCCAACCTGGGCTCCGTTCGGG - Intronic
1152437908 17:80287456-80287478 TTGCACCCTGCACTCCATCCTGG + Intronic
1152599189 17:81252996-81253018 TTGCAGGCTGGACACCCTGCGGG - Intronic
1153782645 18:8507605-8507627 GTCCAGCCTGGACAACGTGCCGG + Intergenic
1155871724 18:31037852-31037874 CTCCAGCCTGCACTCCAGCCTGG + Intronic
1155885668 18:31205317-31205339 CTCCACCTTGAACTCCATGCTGG - Intergenic
1157617969 18:48998557-48998579 TCTCAGCCTCGGCTCCATGCTGG + Intergenic
1160044504 18:75374152-75374174 TTCCAGCCTGGAGCCCAGGAAGG - Intergenic
1160502253 18:79407487-79407509 CTCCAGCCTGCACTCCAGCCTGG - Intronic
1163046713 19:14648334-14648356 TTCCAGCCTGTCCTCTGTGCAGG - Intronic
1164014666 19:21242785-21242807 CTCCAGCCTGCACTCCAGCCTGG + Intronic
1165351182 19:35276888-35276910 TTCCACCCTGGACCCCAGCCTGG + Intronic
1165417801 19:35705475-35705497 ATCCAACCTGGACTCCATACTGG - Intronic
1165419650 19:35716599-35716621 TCCCAGCCTGGCCTCCATGCAGG + Exonic
1165855196 19:38875749-38875771 TTCCTGCCTGGAATGCACGCAGG + Intronic
1167421420 19:49405922-49405944 TTCCAGCCTGGGCAACATGAGGG + Intronic
1167554848 19:50188161-50188183 TCCCAGCCTGCATTCCATTCGGG + Intergenic
925169451 2:1742106-1742128 ATCCAGCCAGGACTCCATTCTGG + Intronic
926803735 2:16685391-16685413 TTCCAGGCTGTTCTCCATTCTGG - Intergenic
926994280 2:18717081-18717103 CTCCAGCCTGGACTACAGCCTGG - Intergenic
927216099 2:20668558-20668580 TTCCCTCCTGCCCTCCATGCTGG - Intronic
928292808 2:30054748-30054770 TTCCAGCCTTGACTCCTGGCTGG + Intergenic
928454179 2:31404364-31404386 TTCCAGCCTGGAGACCTTTCTGG + Intronic
929463737 2:42126166-42126188 TTCCAGCCGGGACACCATTGAGG - Intergenic
930025425 2:47026438-47026460 CTCCAGCCTGGCCTCTGTGCAGG - Intronic
930381250 2:50632885-50632907 TTAAAGCCTGGACTCTCTGCTGG - Intronic
930693451 2:54387807-54387829 ATGCAGCCTGTCCTCCATGCTGG + Intergenic
930806417 2:55495064-55495086 CTCCAGCCTGCACTCCAGCCTGG + Intergenic
933633309 2:84680675-84680697 TTCCATTCTGGTCTCCCTGCTGG - Intronic
934896198 2:98122227-98122249 GGCCAGCCTGGACTCCCTGTGGG + Intronic
934993517 2:98937107-98937129 TCGCAGCCTGGGCTCCCTGCTGG - Intergenic
935230345 2:101090440-101090462 TCGCTGTCTGGACTCCATGCTGG + Intronic
935948630 2:108308876-108308898 CTCCAGCCTGGGCTCAATCCTGG + Exonic
935987565 2:108689429-108689451 CTCCTGGCTGGACTCCATGCAGG - Intergenic
936126392 2:109792130-109792152 CTCCTGGCTGGACTCCATGCAGG - Intergenic
936218301 2:110579338-110579360 CTCCTGGCTGGACTCCATGCAGG + Intergenic
937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG + Intronic
938061753 2:128260665-128260687 TTCCAGCGGGCACTCCATGAGGG - Intronic
938095284 2:128457369-128457391 ATCCAGCCTGGCCAGCATGCGGG - Intergenic
939145399 2:138408700-138408722 ATCTAGCATGGACTCTATGCTGG + Intergenic
940105651 2:150096863-150096885 GTCCAGGATGGTCTCCATGCTGG - Intergenic
940307657 2:152243930-152243952 TTCCAGAGTGGACTCAGTGCAGG - Intergenic
941796939 2:169609416-169609438 GCCCAGGCTGGACTCCAGGCTGG + Intronic
941796942 2:169609418-169609440 TCCCAGCCTGGAGTCCAGCCTGG - Intronic
941874637 2:170420154-170420176 TTCCAGCCTGGGCTACAAGAGGG + Intronic
943340638 2:186676546-186676568 TTCCAGCTTGGCCTACATACTGG + Intronic
944330917 2:198465400-198465422 TTGCAGTGTTGACTCCATGCTGG + Intronic
944679233 2:202061831-202061853 TTTCAGCTTGGACTCTAAGCAGG - Intergenic
945880309 2:215318212-215318234 TTGCATCCTGCAGTCCATGCTGG + Exonic
946179897 2:217942846-217942868 TCCCAGGCTGGGCTCCCTGCAGG - Intronic
946199791 2:218064888-218064910 TTCAAGGCTGGGCTCCCTGCAGG - Intronic
946608009 2:221427115-221427137 TTCCAGCCTAGTCTACAGGCAGG + Intronic
947565834 2:231192392-231192414 TCCCAGCCCGGAGTCCATGTAGG - Intergenic
947577057 2:231283969-231283991 TCCCATCTTGGCCTCCATGCAGG + Intronic
947752321 2:232539551-232539573 TTCCAGGATGGACACAATGCTGG - Intergenic
949000756 2:241611359-241611381 GCCCAGGCTGGCCTCCATGCAGG + Intronic
1169001041 20:2168261-2168283 TTCCAGGCGGGACTCCTTGGAGG - Intronic
1170475422 20:16709502-16709524 CGCTAGCCTGGACTCCATGTGGG + Intergenic
1172169260 20:32918961-32918983 TTACAGCCTGGTCTCCAAGCAGG - Intronic
1172635244 20:36405812-36405834 CCCCAGCCTGGAGTCCATGTGGG - Intronic
1173098728 20:40063585-40063607 TACCAGCCTGGACAACATGGTGG - Intergenic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1174190300 20:48735632-48735654 GTGCAGCCTGTACTACATGCTGG - Intronic
1174410734 20:50333347-50333369 AGGCAGCCTGGAGTCCATGCTGG + Intergenic
1174584784 20:51599998-51600020 TCCCAGGATGGACTACATGCCGG - Exonic
1177608203 21:23409077-23409099 TGCCAGTCTGGACACCAGGCTGG + Intergenic
1178314497 21:31557876-31557898 CGCCAGCCTGGACCCCAGGCTGG + Intronic
1178314499 21:31557878-31557900 TCCCAGCCTGGGGTCCAGGCTGG - Intronic
1180002168 21:45000136-45000158 CTCCACCCTGGGCGCCATGCTGG + Intergenic
1180873392 22:19161288-19161310 TCCCAGCCTGGCCGCCTTGCAGG + Intergenic
1181011408 22:20043042-20043064 ATGGAGCCTGGGCTCCATGCCGG - Intronic
1183317222 22:37143291-37143313 CTGCAGCCTGGACTCCACCCAGG + Intronic
1184198146 22:42945922-42945944 TTACAGCCTGGAGGCCCTGCTGG - Intronic
1184337321 22:43861711-43861733 TTCCAGCCTGGGCTCCGGGTGGG - Intronic
1184816540 22:46876159-46876181 TACCATCCTTGACTCCATCCTGG + Intronic
1185273996 22:49942074-49942096 TTCCACCCTGGCCAGCATGCAGG - Intergenic
949917324 3:8975188-8975210 CTCCATACTGGACTCCAGGCTGG - Intergenic
950926724 3:16748148-16748170 TCCCAGCCTGGACTTCAATCCGG + Intergenic
954139731 3:48598682-48598704 TCCCAGCCTGGAATCCCTGCAGG - Intergenic
955179179 3:56650563-56650585 TTACTGCCTGGATTCCATGAGGG + Intronic
955559310 3:60171735-60171757 TTCCAGCCTGGGCTGTATACAGG - Intronic
956292143 3:67672306-67672328 TTCTAGCCTGCCCTGCATGCTGG - Intergenic
962816589 3:139006131-139006153 TTCCAGGCTGGGCGCCACGCGGG + Exonic
965218790 3:165899893-165899915 TTCCATACTGGACTGCATGAAGG + Intergenic
965995826 3:174881638-174881660 ATCCAACTTGTACTCCATGCGGG + Intronic
966207490 3:177419980-177420002 TCCCACCCTGGCCTCCATGAAGG + Intergenic
967161756 3:186745409-186745431 TTTCAGCCTAGACTCCCAGCTGG - Intergenic
968810685 4:2798455-2798477 TCTGAGCCTGGTCTCCATGCAGG - Intronic
969056124 4:4403954-4403976 TTCCAGCTTAGGCTACATGCGGG + Intronic
969581882 4:8070702-8070724 TTCCACCCTGGGCTAGATGCTGG - Intronic
970496317 4:16629279-16629301 TTGGAGCTTGAACTCCATGCTGG - Intronic
971251619 4:24977261-24977283 TTCCATCGAGGACTCCAAGCTGG + Intronic
976183462 4:82421166-82421188 CTCCAGCCTGCACTCCAGCCTGG + Intergenic
977115367 4:93017761-93017783 CTCCAGCCAGGACTCCAGCCAGG + Intronic
982363996 4:154555345-154555367 TTGCATCCTGAAATCCATGCTGG + Intergenic
982661317 4:158210331-158210353 ATCCAGCCTTGACTTCCTGCTGG - Exonic
982671003 4:158320117-158320139 TGCCAGCAGGAACTCCATGCGGG + Intronic
985884478 5:2666257-2666279 ATCAAGCCTGGGCTGCATGCGGG + Intergenic
987108489 5:14663882-14663904 TTCCGCCCTGGACTCCTCGCGGG + Intergenic
990257578 5:53987108-53987130 TTCCTGCCTAGACACCATGGAGG - Intronic
990287146 5:54311138-54311160 TTCCAGCCTGGTGTCCCTGAGGG + Intergenic
992132093 5:73703538-73703560 TTCCCTCCTGGACTCCTTGAAGG - Intronic
997525238 5:134548793-134548815 CTCCAGCCTGGGCTGAATGCTGG + Intronic
997641231 5:135450075-135450097 TTCCAGCCTTGGCTCCATCCTGG - Intronic
998113168 5:139517651-139517673 ATCCAGCCTGGAGTCGATGTTGG + Intergenic
999836738 5:155381853-155381875 TTCCATCCTGAACCTCATGCTGG - Intergenic
1001641880 5:173250168-173250190 TTCCATCCTGGGCCCCAGGCTGG + Intergenic
1002622983 5:180503217-180503239 TTCAAGCCAGGACTTGATGCAGG + Intronic
1003102293 6:3186118-3186140 TTCCAGCCTGCCCTCCACACAGG - Intergenic
1003312060 6:4977939-4977961 CTCTAGCCTGGACACCATGCAGG - Intergenic
1005043045 6:21616503-21616525 CTCCAGCCTGCACTCCAGCCTGG - Intergenic
1007257032 6:40536666-40536688 TGCCTGCAGGGACTCCATGCAGG + Intronic
1008208718 6:48694443-48694465 TTCCTGCCTGGCCACCCTGCAGG + Intergenic
1009791812 6:68411813-68411835 TTCAAGCCTGGATTCAAAGCTGG + Intergenic
1011633866 6:89352698-89352720 GTCCAGCCTGGACTGCGGGCGGG + Exonic
1014029479 6:116683950-116683972 TCCCAGGCTGGAGTCCAGGCTGG + Intronic
1014029481 6:116683952-116683974 CTCCAGCCTGGACTCCAGCCTGG - Intronic
1015224503 6:130841490-130841512 TTCCTGCCTCTACTCCTTGCCGG - Intronic
1015311394 6:131770897-131770919 TACCATCCTGGCCTCCTTGCTGG - Intergenic
1016995598 6:149960634-149960656 TTCCAGGCTGGACCCTAAGCAGG - Intergenic
1017034638 6:150256112-150256134 TTCCTCCCTGCACTCCATGTTGG + Intergenic
1017136902 6:151155394-151155416 CTCCAGCCTGCACTCCAGCCTGG - Intergenic
1017994436 6:159520316-159520338 GTCCAGGCTGTTCTCCATGCAGG - Intergenic
1018318407 6:162581005-162581027 TTCTAGCATTGACTCCATTCTGG - Intronic
1018468772 6:164078506-164078528 TTCCAGCTTGGAAACCATGATGG - Intergenic
1020140243 7:5607799-5607821 TTCCAGCCTGGCTTTCATGGGGG - Intergenic
1021317794 7:19171447-19171469 TTCCATCCAGAACTCCCTGCCGG + Intergenic
1024081968 7:45863673-45863695 TTCCAGTCTCTACTCCATCCTGG - Intergenic
1024668150 7:51566020-51566042 TTTCAGCCAGGACTGCAGGCAGG - Intergenic
1026909269 7:74083289-74083311 GCCCAGCCTGGCCTCAATGCAGG + Intronic
1027783056 7:82543820-82543842 TTCCAGCCTGGACAACATAATGG + Intergenic
1028379352 7:90181519-90181541 TTCCAGCCTGCCCACCATGCTGG + Intronic
1029621927 7:101695528-101695550 TTCAAGCCTGCACTCCAGCCTGG + Intergenic
1029680020 7:102102006-102102028 TTCCAGAATGGACTCCAGACAGG - Intronic
1031712755 7:125069574-125069596 TTCCAGTTTGGACTCCATATGGG + Intergenic
1034391790 7:150792976-150792998 TTTGAGCTTGGACTTCATGCTGG - Intronic
1034872517 7:154696601-154696623 TGCCAGCCTGGTCCCCATCCAGG + Intronic
1035242669 7:157542469-157542491 TTCCAGCCTCCACTGCATGATGG - Intronic
1035996358 8:4551712-4551734 TCCCAGGCTGGAGTCCAGGCTGG + Intronic
1035996360 8:4551714-4551736 CTCCAGCCTGGACTCCAGCCTGG - Intronic
1038984144 8:32790520-32790542 TTCCCTACTGGACTCCATCCTGG - Intergenic
1041065759 8:54081492-54081514 TTACAGGCTGCACTCCATCCTGG - Intronic
1041440987 8:57896799-57896821 TTCAACCCTGAACTCCATGCAGG + Intergenic
1042917258 8:73887887-73887909 TTCCAGCCTGTTCTCCATAGTGG - Intergenic
1048555406 8:135471064-135471086 TTCCATGCTGGGCTCCATGAAGG - Intronic
1048790332 8:138097996-138098018 CTCCAGCCTGGACTCCAGCCTGG - Intergenic
1049003257 8:139839287-139839309 TTCCAGAGTGGTCTCCATGATGG - Intronic
1050122330 9:2320471-2320493 TTCCAGCCTGGAGTTGATGGAGG + Intergenic
1050359340 9:4814392-4814414 TTCCGGCCTGGTCTCCCTACAGG + Intronic
1050824147 9:9922876-9922898 TTCTAGGTTGGACTCCATGCTGG + Intronic
1050835491 9:10073227-10073249 TTACAGCCTGCATTCCATCCTGG - Intronic
1050840576 9:10143480-10143502 TTCCAGACTGCTCTCCATGGTGG - Intronic
1051308865 9:15747378-15747400 TTCGAGCTTGAACACCATGCTGG - Intronic
1051353209 9:16217775-16217797 TTCCAGCCGAGGCTCCATGCTGG - Intronic
1053263021 9:36687170-36687192 TTCCAGACTCTACTACATGCTGG - Intergenic
1056956648 9:91087489-91087511 TTCCAGCCTGGTCTCTCTCCTGG - Intergenic
1058835291 9:108854757-108854779 TTCCATCCTGGCCTCCCTGCAGG - Exonic
1061666376 9:132162866-132162888 TTCCAGGTTCGACTCCACGCCGG - Intronic
1186966140 X:14788147-14788169 TTCCAGCCTGGTCACAATACAGG - Intergenic
1187912188 X:24121114-24121136 CTCCAGCCTGCACTCCAGCCTGG + Intergenic
1188326306 X:28806480-28806502 TTCCAGCCACGCTTCCATGCAGG - Intronic
1189207860 X:39257208-39257230 CCACAGCCTAGACTCCATGCTGG - Intergenic
1190224801 X:48537091-48537113 CTCCAGCCTGCACTCCAACCTGG - Intergenic
1190623868 X:52317163-52317185 TTCCTGCCTCATCTCCATGCTGG + Intergenic
1191688483 X:63916378-63916400 TTTTAGCCTGGTCTCTATGCTGG - Intergenic
1192317643 X:70065533-70065555 CTCCAGCCTGGACCCTTTGCAGG - Intergenic
1194756867 X:97747973-97747995 CTCCAGCCTGCACTCCAGCCTGG - Intergenic
1195211498 X:102655175-102655197 TTGTAGACTGGACTCTATGCTGG - Exonic
1197213109 X:123844437-123844459 TCCCAGCCTGCATTCCATCCTGG - Intergenic
1197414995 X:126164739-126164761 TTCCAGCCTGGACTCCATGCCGG - Exonic
1200090722 X:153634647-153634669 TTCCAGCCTCCCCTCAATGCTGG - Intergenic
1200123985 X:153804657-153804679 TTTCAGCATGGACTCTCTGCTGG - Exonic