ID: 1197419126

View in Genome Browser
Species Human (GRCh38)
Location X:126216216-126216238
Sequence GTTTTAAAGAAAATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197419124_1197419126 3 Left 1197419124 X:126216190-126216212 CCATATTTTATTTTATAATATTA No data
Right 1197419126 X:126216216-126216238 GTTTTAAAGAAAATTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197419126 Original CRISPR GTTTTAAAGAAAATTGAGGA TGG Intergenic
No off target data available for this crispr