ID: 1197420066

View in Genome Browser
Species Human (GRCh38)
Location X:126227715-126227737
Sequence ATGCTGACTCAGAGCATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197420066_1197420071 18 Left 1197420066 X:126227715-126227737 CCCTGTATGCTCTGAGTCAGCAT No data
Right 1197420071 X:126227756-126227778 TCTCCCATAGCCAGGTTTCACGG No data
1197420066_1197420070 10 Left 1197420066 X:126227715-126227737 CCCTGTATGCTCTGAGTCAGCAT No data
Right 1197420070 X:126227748-126227770 GTACTGTTTCTCCCATAGCCAGG 0: 151
1: 207
2: 173
3: 141
4: 198
1197420066_1197420072 19 Left 1197420066 X:126227715-126227737 CCCTGTATGCTCTGAGTCAGCAT No data
Right 1197420072 X:126227757-126227779 CTCCCATAGCCAGGTTTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197420066 Original CRISPR ATGCTGACTCAGAGCATACA GGG (reversed) Intergenic
No off target data available for this crispr