ID: 1197424108

View in Genome Browser
Species Human (GRCh38)
Location X:126273462-126273484
Sequence GGAGCTCTGCTTGCCCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197424096_1197424108 25 Left 1197424096 X:126273414-126273436 CCTGGGTGGGGTAGCACAATCAC No data
Right 1197424108 X:126273462-126273484 GGAGCTCTGCTTGCCCCATGTGG No data
1197424106_1197424108 -7 Left 1197424106 X:126273446-126273468 CCCTTGGCTGGGGGTGGGAGCTC 0: 17
1: 54
2: 154
3: 734
4: 1502
Right 1197424108 X:126273462-126273484 GGAGCTCTGCTTGCCCCATGTGG No data
1197424102_1197424108 -1 Left 1197424102 X:126273440-126273462 CCACCTCCCTTGGCTGGGGGTGG No data
Right 1197424108 X:126273462-126273484 GGAGCTCTGCTTGCCCCATGTGG No data
1197424107_1197424108 -8 Left 1197424107 X:126273447-126273469 CCTTGGCTGGGGGTGGGAGCTCT No data
Right 1197424108 X:126273462-126273484 GGAGCTCTGCTTGCCCCATGTGG No data
1197424105_1197424108 -4 Left 1197424105 X:126273443-126273465 CCTCCCTTGGCTGGGGGTGGGAG No data
Right 1197424108 X:126273462-126273484 GGAGCTCTGCTTGCCCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197424108 Original CRISPR GGAGCTCTGCTTGCCCCATG TGG Intergenic
No off target data available for this crispr