ID: 1197426445

View in Genome Browser
Species Human (GRCh38)
Location X:126302866-126302888
Sequence TTAGATTACCAGGACTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197426445_1197426448 5 Left 1197426445 X:126302866-126302888 CCAATAGAGTCCTGGTAATCTAA No data
Right 1197426448 X:126302894-126302916 TTTTTCAAAATATCAAATGGAGG No data
1197426445_1197426449 11 Left 1197426445 X:126302866-126302888 CCAATAGAGTCCTGGTAATCTAA No data
Right 1197426449 X:126302900-126302922 AAAATATCAAATGGAGGAGATGG No data
1197426445_1197426447 2 Left 1197426445 X:126302866-126302888 CCAATAGAGTCCTGGTAATCTAA No data
Right 1197426447 X:126302891-126302913 TTTTTTTTCAAAATATCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197426445 Original CRISPR TTAGATTACCAGGACTCTAT TGG (reversed) Intergenic
No off target data available for this crispr