ID: 1197435290

View in Genome Browser
Species Human (GRCh38)
Location X:126420584-126420606
Sequence CTTCAAAAACTGAAGATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197435290_1197435293 15 Left 1197435290 X:126420584-126420606 CCTTCTATCTTCAGTTTTTGAAG No data
Right 1197435293 X:126420622-126420644 GGATTCTAAAGTCCATCAAGTGG No data
1197435290_1197435292 -6 Left 1197435290 X:126420584-126420606 CCTTCTATCTTCAGTTTTTGAAG No data
Right 1197435292 X:126420601-126420623 TTGAAGGTTTTTATCATAAAAGG 0: 12
1: 123
2: 618
3: 2032
4: 10155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197435290 Original CRISPR CTTCAAAAACTGAAGATAGA AGG (reversed) Intergenic
No off target data available for this crispr