ID: 1197435292

View in Genome Browser
Species Human (GRCh38)
Location X:126420601-126420623
Sequence TTGAAGGTTTTTATCATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12940
Summary {0: 12, 1: 123, 2: 618, 3: 2032, 4: 10155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197435290_1197435292 -6 Left 1197435290 X:126420584-126420606 CCTTCTATCTTCAGTTTTTGAAG No data
Right 1197435292 X:126420601-126420623 TTGAAGGTTTTTATCATAAAAGG 0: 12
1: 123
2: 618
3: 2032
4: 10155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197435292 Original CRISPR TTGAAGGTTTTTATCATAAA AGG Intergenic
Too many off-targets to display for this crispr