ID: 1197435292 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:126420601-126420623 |
| Sequence | TTGAAGGTTTTTATCATAAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 12940 | |||
| Summary | {0: 12, 1: 123, 2: 618, 3: 2032, 4: 10155} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197435290_1197435292 | -6 | Left | 1197435290 | X:126420584-126420606 | CCTTCTATCTTCAGTTTTTGAAG | No data | ||
| Right | 1197435292 | X:126420601-126420623 | TTGAAGGTTTTTATCATAAAAGG | 0: 12 1: 123 2: 618 3: 2032 4: 10155 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197435292 | Original CRISPR | TTGAAGGTTTTTATCATAAA AGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||