ID: 1197435293

View in Genome Browser
Species Human (GRCh38)
Location X:126420622-126420644
Sequence GGATTCTAAAGTCCATCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197435290_1197435293 15 Left 1197435290 X:126420584-126420606 CCTTCTATCTTCAGTTTTTGAAG No data
Right 1197435293 X:126420622-126420644 GGATTCTAAAGTCCATCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197435293 Original CRISPR GGATTCTAAAGTCCATCAAG TGG Intergenic
No off target data available for this crispr