ID: 1197439220

View in Genome Browser
Species Human (GRCh38)
Location X:126470281-126470303
Sequence AGGGAAAGCATAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197439209_1197439220 29 Left 1197439209 X:126470229-126470251 CCCCACATCCTGCAGCATCAGCC No data
Right 1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG No data
1197439210_1197439220 28 Left 1197439210 X:126470230-126470252 CCCACATCCTGCAGCATCAGCCA No data
Right 1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG No data
1197439215_1197439220 8 Left 1197439215 X:126470250-126470272 CCATGGCATGGAGAATCTGTGTA No data
Right 1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG No data
1197439213_1197439220 21 Left 1197439213 X:126470237-126470259 CCTGCAGCATCAGCCATGGCATG No data
Right 1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG No data
1197439211_1197439220 27 Left 1197439211 X:126470231-126470253 CCACATCCTGCAGCATCAGCCAT No data
Right 1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197439220 Original CRISPR AGGGAAAGCATAGTGATTGT GGG Intergenic
No off target data available for this crispr