ID: 1197446166

View in Genome Browser
Species Human (GRCh38)
Location X:126553572-126553594
Sequence CCTTCCACTCCCTCTCCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197446166_1197446172 -9 Left 1197446166 X:126553572-126553594 CCCTAAGGAGAGGGAGTGGAAGG No data
Right 1197446172 X:126553586-126553608 AGTGGAAGGATCCTGAGAGGGGG No data
1197446166_1197446171 -10 Left 1197446166 X:126553572-126553594 CCCTAAGGAGAGGGAGTGGAAGG No data
Right 1197446171 X:126553585-126553607 GAGTGGAAGGATCCTGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197446166 Original CRISPR CCTTCCACTCCCTCTCCTTA GGG (reversed) Intergenic
No off target data available for this crispr