ID: 1197477361

View in Genome Browser
Species Human (GRCh38)
Location X:126941361-126941383
Sequence AGTTATCTGCATAAGATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197477356_1197477361 22 Left 1197477356 X:126941316-126941338 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG No data
1197477357_1197477361 16 Left 1197477357 X:126941322-126941344 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG No data
1197477358_1197477361 15 Left 1197477358 X:126941323-126941345 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG No data
1197477360_1197477361 4 Left 1197477360 X:126941334-126941356 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG No data
1197477355_1197477361 25 Left 1197477355 X:126941313-126941335 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197477361 Original CRISPR AGTTATCTGCATAAGATGAC AGG Intergenic
No off target data available for this crispr