ID: 1197478935

View in Genome Browser
Species Human (GRCh38)
Location X:126959123-126959145
Sequence ATGATTGAAATACTATTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197478934_1197478935 2 Left 1197478934 X:126959098-126959120 CCTCAGATTCTATGCATCAGATT No data
Right 1197478935 X:126959123-126959145 ATGATTGAAATACTATTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197478935 Original CRISPR ATGATTGAAATACTATTGAA TGG Intergenic
No off target data available for this crispr