ID: 1197480859

View in Genome Browser
Species Human (GRCh38)
Location X:126984217-126984239
Sequence ATTCTAAGTGCACCACAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197480859_1197480863 28 Left 1197480859 X:126984217-126984239 CCTGGTTGTGGTGCACTTAGAAT No data
Right 1197480863 X:126984268-126984290 CACATAATCATTGTATATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197480859 Original CRISPR ATTCTAAGTGCACCACAACC AGG (reversed) Intergenic
No off target data available for this crispr