ID: 1197493957

View in Genome Browser
Species Human (GRCh38)
Location X:127154163-127154185
Sequence GGGACGTGGCCTAAAAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197493957_1197493962 0 Left 1197493957 X:127154163-127154185 CCATGGCTTTTAGGCCACGTCCC No data
Right 1197493962 X:127154186-127154208 TCCCCATCAGCTAGTAAGGCTGG No data
1197493957_1197493964 1 Left 1197493957 X:127154163-127154185 CCATGGCTTTTAGGCCACGTCCC No data
Right 1197493964 X:127154187-127154209 CCCCATCAGCTAGTAAGGCTGGG No data
1197493957_1197493959 -4 Left 1197493957 X:127154163-127154185 CCATGGCTTTTAGGCCACGTCCC No data
Right 1197493959 X:127154182-127154204 TCCCTCCCCATCAGCTAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197493957 Original CRISPR GGGACGTGGCCTAAAAGCCA TGG (reversed) Intergenic
No off target data available for this crispr