ID: 1197504262

View in Genome Browser
Species Human (GRCh38)
Location X:127282105-127282127
Sequence CTTTAATCATAAATGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197504262_1197504267 2 Left 1197504262 X:127282105-127282127 CCAGCATCCATTTATGATTAAAG No data
Right 1197504267 X:127282130-127282152 CTCAGCAAAACTGGCATACAAGG 0: 17
1: 148
2: 396
3: 521
4: 758
1197504262_1197504268 3 Left 1197504262 X:127282105-127282127 CCAGCATCCATTTATGATTAAAG No data
Right 1197504268 X:127282131-127282153 TCAGCAAAACTGGCATACAAGGG 0: 22
1: 150
2: 405
3: 537
4: 652
1197504262_1197504264 -7 Left 1197504262 X:127282105-127282127 CCAGCATCCATTTATGATTAAAG No data
Right 1197504264 X:127282121-127282143 ATTAAAGCCCTCAGCAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197504262 Original CRISPR CTTTAATCATAAATGGATGC TGG (reversed) Intergenic
No off target data available for this crispr