ID: 1197514697

View in Genome Browser
Species Human (GRCh38)
Location X:127411270-127411292
Sequence AGAGACAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197514697_1197514702 23 Left 1197514697 X:127411270-127411292 CCCACAATCACTGTGCTGTCTCT No data
Right 1197514702 X:127411316-127411338 CATGTTACATGACCCTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197514697 Original CRISPR AGAGACAGCACAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr