ID: 1197521993

View in Genome Browser
Species Human (GRCh38)
Location X:127510339-127510361
Sequence AGTTATCTGTAGATGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197521993_1197521998 10 Left 1197521993 X:127510339-127510361 CCTGCCACCATCTACAGATAACT No data
Right 1197521998 X:127510372-127510394 GGCAGCTCATGGCATGCTACTGG No data
1197521993_1197521997 -1 Left 1197521993 X:127510339-127510361 CCTGCCACCATCTACAGATAACT No data
Right 1197521997 X:127510361-127510383 TACTCTTGAGAGGCAGCTCATGG No data
1197521993_1197521999 11 Left 1197521993 X:127510339-127510361 CCTGCCACCATCTACAGATAACT No data
Right 1197521999 X:127510373-127510395 GCAGCTCATGGCATGCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197521993 Original CRISPR AGTTATCTGTAGATGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr