ID: 1197533271

View in Genome Browser
Species Human (GRCh38)
Location X:127657382-127657404
Sequence CCCATAAACTTCTACATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197533269_1197533271 -9 Left 1197533269 X:127657368-127657390 CCAATATTCTAAAACCCATAAAC No data
Right 1197533271 X:127657382-127657404 CCCATAAACTTCTACATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197533271 Original CRISPR CCCATAAACTTCTACATTAC AGG Intergenic
No off target data available for this crispr