ID: 1197539233

View in Genome Browser
Species Human (GRCh38)
Location X:127734762-127734784
Sequence CATGATCTCTGATAAGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197539233_1197539237 30 Left 1197539233 X:127734762-127734784 CCTTTGACTTATCAGAGATCATG No data
Right 1197539237 X:127734815-127734837 TCTTGATTAGTGAGAGAGGGTGG No data
1197539233_1197539235 26 Left 1197539233 X:127734762-127734784 CCTTTGACTTATCAGAGATCATG No data
Right 1197539235 X:127734811-127734833 TAAGTCTTGATTAGTGAGAGAGG No data
1197539233_1197539236 27 Left 1197539233 X:127734762-127734784 CCTTTGACTTATCAGAGATCATG No data
Right 1197539236 X:127734812-127734834 AAGTCTTGATTAGTGAGAGAGGG No data
1197539233_1197539234 -8 Left 1197539233 X:127734762-127734784 CCTTTGACTTATCAGAGATCATG No data
Right 1197539234 X:127734777-127734799 AGATCATGCAAGCAATAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197539233 Original CRISPR CATGATCTCTGATAAGTCAA AGG (reversed) Intergenic
No off target data available for this crispr