ID: 1197544324

View in Genome Browser
Species Human (GRCh38)
Location X:127806259-127806281
Sequence CTGAATTGGATTAAGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197544324_1197544328 1 Left 1197544324 X:127806259-127806281 CCCTCCAACTTAATCCAATTCAG No data
Right 1197544328 X:127806283-127806305 CAGTTATTCAAATTGAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197544324 Original CRISPR CTGAATTGGATTAAGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr