ID: 1197545332

View in Genome Browser
Species Human (GRCh38)
Location X:127816606-127816628
Sequence CGGGAAATGGCAGTAGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197545324_1197545332 13 Left 1197545324 X:127816570-127816592 CCGGAGGGATGGAAGTCAGCGGT 0: 10
1: 44
2: 108
3: 118
4: 166
Right 1197545332 X:127816606-127816628 CGGGAAATGGCAGTAGTGGACGG No data
1197545322_1197545332 19 Left 1197545322 X:127816564-127816586 CCGGATCCGGAGGGATGGAAGTC No data
Right 1197545332 X:127816606-127816628 CGGGAAATGGCAGTAGTGGACGG No data
1197545321_1197545332 23 Left 1197545321 X:127816560-127816582 CCTGCCGGATCCGGAGGGATGGA No data
Right 1197545332 X:127816606-127816628 CGGGAAATGGCAGTAGTGGACGG No data
1197545319_1197545332 24 Left 1197545319 X:127816559-127816581 CCCTGCCGGATCCGGAGGGATGG No data
Right 1197545332 X:127816606-127816628 CGGGAAATGGCAGTAGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197545332 Original CRISPR CGGGAAATGGCAGTAGTGGA CGG Intergenic
No off target data available for this crispr