ID: 1197548861

View in Genome Browser
Species Human (GRCh38)
Location X:127862479-127862501
Sequence GCACCATTGTTAGCAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 2, 1: 4, 2: 15, 3: 38, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197548861_1197548865 9 Left 1197548861 X:127862479-127862501 CCTGGACCTGCTAACAATGGTGC 0: 2
1: 4
2: 15
3: 38
4: 139
Right 1197548865 X:127862511-127862533 CTGCCCTGCGACACAAGGATAGG No data
1197548861_1197548864 4 Left 1197548861 X:127862479-127862501 CCTGGACCTGCTAACAATGGTGC 0: 2
1: 4
2: 15
3: 38
4: 139
Right 1197548864 X:127862506-127862528 ATATGCTGCCCTGCGACACAAGG No data
1197548861_1197548868 18 Left 1197548861 X:127862479-127862501 CCTGGACCTGCTAACAATGGTGC 0: 2
1: 4
2: 15
3: 38
4: 139
Right 1197548868 X:127862520-127862542 GACACAAGGATAGGCACAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197548861 Original CRISPR GCACCATTGTTAGCAGGTCC AGG (reversed) Intergenic
902099813 1:13977676-13977698 GCAACATTGTTATAAGTTCCAGG - Intergenic
906573263 1:46862703-46862725 GCACCAGTGTTGGCTGCTCCAGG - Intergenic
906598613 1:47104391-47104413 GCACCAGTGTTAGCTACTCCAGG + Intronic
906762457 1:48388036-48388058 GCAGCAATTTTAGCTGGTCCTGG - Intronic
908538764 1:65103217-65103239 GCACCAACGTTAGTGGGTCCTGG + Intergenic
908930827 1:69314818-69314840 GCACCATTGTTTACAGGTCAAGG + Intergenic
909183308 1:72451124-72451146 AAACCAGTGGTAGCAGGTCCAGG - Intergenic
909268827 1:73597447-73597469 GTACGTTTGTTAGCAGTTCCCGG - Intergenic
909827486 1:80143606-80143628 GCTCCAGTGTTAGGAGGACCAGG - Intergenic
910750007 1:90619031-90619053 GTACGTTTGTTAGCAGTTCCCGG + Intergenic
913057383 1:115175057-115175079 GCCCCAAAGTTAGCAGGTCCTGG - Intergenic
915784833 1:158598032-158598054 ACACCTGTGTTAGCAGGTACTGG - Intergenic
919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
919590310 1:199493865-199493887 GCACCAGTGTTAGTGGGTCCTGG - Intergenic
920804122 1:209216925-209216947 GCACCAATGTTAGTGGGCCCAGG - Intergenic
921679779 1:218017282-218017304 GTACGTTTGTTAGCAGCTCCTGG - Intergenic
923533098 1:234827277-234827299 GCACCACTGCTAACAGGTGCAGG + Intergenic
1062853081 10:760152-760174 GCACTGGTGGTAGCAGGTCCTGG - Intergenic
1063548850 10:7009108-7009130 GTACATTTGTTAGCAGTTCCTGG - Intergenic
1068657711 10:59591899-59591921 GCACAGGTGTTAGCGGGTCCAGG - Intergenic
1071666641 10:87564638-87564660 GCACCAGTGTCAGCAAGTCCAGG - Intergenic
1072042342 10:91620204-91620226 GTACATTTGTTAGCAGTTCCTGG + Intergenic
1074031964 10:109697674-109697696 ACACCAGTATTAGCAGGACCAGG - Intergenic
1074444514 10:113508801-113508823 GTACATTTGTTAGCAGTTCCTGG - Intergenic
1074683537 10:115935132-115935154 GCACAATTGTTAGCAAATCTAGG + Intronic
1077450901 11:2644989-2645011 GTACCAGTGTTAGCAAGTCCAGG + Intronic
1079131651 11:17750246-17750268 GTGCCATTGTCAGCAGGTCCTGG + Intronic
1084142206 11:67240086-67240108 GCAGCATTGTTCGCAGGCACAGG + Intronic
1084400678 11:68941200-68941222 GCACCATTGGAAGCATCTCCCGG + Intergenic
1085283230 11:75344334-75344356 GCCCTTTTGCTAGCAGGTCCAGG - Intronic
1085493487 11:76945645-76945667 GCACCAGTGTTAGTGGGTACTGG + Intronic
1085542815 11:77288353-77288375 GCACTGGTGTTAGCAGGTCGAGG - Intronic
1086998864 11:93392312-93392334 GCACAATAGTTCACAGGTCCTGG + Intronic
1087011256 11:93516200-93516222 GAACCATGCTTGGCAGGTCCCGG + Intronic
1088777191 11:113096864-113096886 GCAGCATTGTGAGCAGAACCTGG - Intronic
1089090334 11:115869463-115869485 GCACGGATGTTAGCAGGTTCAGG + Intergenic
1095712729 12:45307724-45307746 GCACCAGTGTTTACAGGTCACGG + Intronic
1097846860 12:64375500-64375522 GTACACTTGTTAGCAGTTCCTGG - Intronic
1098634023 12:72758278-72758300 GCACCAGTGTTAGCATGTCCAGG - Intergenic
1100776507 12:97980025-97980047 GCACTGGTGTTGGCAGGTCCAGG - Intergenic
1101567390 12:105921014-105921036 ACACCATTGTAAGGGGGTCCAGG + Intergenic
1108308793 13:49165609-49165631 GTACCAGTGTTAGCAAATCCAGG + Intronic
1109155614 13:58906024-58906046 GCACCAATGTTAGCACTTCTGGG + Intergenic
1111176713 13:84605707-84605729 GCACCAGGGTTAGCAGGTCCAGG + Intergenic
1112080121 13:95959817-95959839 GCACCAGTGTTAGCAGGTGCAGG - Intronic
1112821722 13:103345705-103345727 GCACCAGCGTTAGCAGGTCCAGG + Intergenic
1113536950 13:111075891-111075913 GCACTATTGTTAGCAGGTCCAGG + Intergenic
1114156951 14:20115219-20115241 GCACAAGTGTTTTCAGGTCCTGG + Intergenic
1114565457 14:23628839-23628861 GTACATTTGTTAGCAGCTCCTGG - Intergenic
1115895441 14:38081390-38081412 GCACCATTGTTATCAGATTAGGG + Intergenic
1116150074 14:41129505-41129527 GTACCTTTGTTAACAGGTCCTGG + Intergenic
1116411351 14:44627134-44627156 CCACCATGGTTGTCAGGTCCAGG - Intergenic
1117610754 14:57480622-57480644 GCAACATGGTTAGAAGGTCATGG + Exonic
1120045530 14:79801687-79801709 GCACCATTGCTAGGAGCTACTGG + Intronic
1122355684 14:101121726-101121748 TCACCATTTGTAGCTGGTCCGGG + Intergenic
1124136891 15:27042831-27042853 GCATCACTCTTAGCAGGGCCAGG + Intronic
1124838275 15:33216757-33216779 GCACCATTTTTAGAAGATCCAGG - Intergenic
1126661570 15:51038422-51038444 GCACTGGCGTTAGCAGGTCCAGG + Intergenic
1127410216 15:58697766-58697788 GCACTGGTGTTAGCAGGTCCAGG - Intronic
1129070593 15:72946878-72946900 GCATTGGTGTTAGCAGGTCCAGG - Intergenic
1130166088 15:81460753-81460775 GCTCCAGTGTTAGTGGGTCCTGG + Intergenic
1130398661 15:83529250-83529272 GCACCAGTGTTAGCAGATCCAGG + Intronic
1131473618 15:92717292-92717314 GCTCCATGGTTAGGAGGTCAGGG - Intronic
1132263934 15:100449464-100449486 GCACTAGTGTTAGCAGCTCCAGG - Intronic
1132802255 16:1760197-1760219 GCACCCTTGTTAGAGGCTCCTGG - Intronic
1132869531 16:2109650-2109672 GCACCAATGTGAGCTGGTGCTGG - Exonic
1134717886 16:16365949-16365971 GCACCAATGTGAGCTGGTGCTGG + Intergenic
1134956864 16:18386210-18386232 GCACCAATGTGAGCTGGTGCTGG - Intergenic
1137799023 16:51245603-51245625 ACACCATCGTTAGCAGCTGCAGG - Intergenic
1138597613 16:58037436-58037458 GCAACTCTGTCAGCAGGTCCTGG - Intronic
1138738718 16:59281446-59281468 TCACCAGTGTTATCAGGTCCAGG - Intergenic
1138877475 16:60970412-60970434 ACACAATTGTTGGCAGGACCTGG + Intergenic
1138915314 16:61456111-61456133 GCATCAGTGTTAGTGGGTCCAGG - Intergenic
1138993187 16:62417372-62417394 GCACCAGAGGTAGCAGGTCCAGG + Intergenic
1141021142 16:80497702-80497724 GCTCCATTTTTATCAGTTCCAGG - Intergenic
1143277808 17:5726247-5726269 GCCCGTTTGTTAGCAGTTCCTGG - Intergenic
1144575839 17:16428823-16428845 ACACCACTGTGAGCAGGGCCTGG - Exonic
1156653290 18:39252549-39252571 GCACTGGTGTTAGCAAGTCCAGG - Intergenic
1158002293 18:52633399-52633421 GTGCCATTGTTGGCAGATCCTGG + Intronic
1158735714 18:60076048-60076070 GCACCAGTGTTTACAGGTTCAGG - Intergenic
1159460771 18:68720265-68720287 GCATCATTATTAGCAGGTTTTGG - Intronic
1162573779 19:11487084-11487106 GCACCGTTGTTGCCAGCTCCGGG + Exonic
1162619128 19:11826704-11826726 GCACCATTGTACTCCGGTCCGGG - Intronic
1163376139 19:16931638-16931660 GTACCAGTGTTAGTGGGTCCAGG - Intronic
1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG + Intergenic
1167347274 19:48954621-48954643 GCACCATTTTTAGAAGTTTCGGG - Intergenic
1167986506 19:53322833-53322855 GCACCAATGTTAGTGAGTCCAGG + Intergenic
927262158 2:21102506-21102528 GCACAAATGTGAGCAGGTGCAGG + Intergenic
928258890 2:29749252-29749274 CCACCAATGTTAGCATTTCCTGG - Intronic
930539111 2:52681634-52681656 GCACCAATGTTAGCAGGTCCAGG - Intergenic
933821351 2:86115109-86115131 GAACCATTCTTAGCAGTTCTAGG + Intronic
935412621 2:102781574-102781596 GCTCCATTGTTACAAGGTCAGGG + Intronic
936785849 2:116094001-116094023 GCACTGGTGTTAGCAGGTCCAGG + Intergenic
937465587 2:122130801-122130823 GTACCAGTGTTAGTTGGTCCAGG + Intergenic
939872600 2:147541777-147541799 GTACCATTGTGAGCAGGCACTGG - Intergenic
940362592 2:152812756-152812778 ACACCAGAGTTAGCGGGTCCTGG + Intergenic
943714404 2:191134394-191134416 GCACCAGTGTTAGCAAGTCCAGG - Intronic
944048656 2:195440875-195440897 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
944260114 2:197667875-197667897 GCACTGGTGTTAGCAGGTCCAGG + Intronic
945483706 2:210370245-210370267 GCACCAGTGTCAGTGGGTCCAGG + Intergenic
945971152 2:216233580-216233602 GCACCAGTGTGAGCAGGTTCAGG + Intergenic
1169182824 20:3585047-3585069 CCACCACTCTCAGCAGGTCCAGG - Intronic
1169412503 20:5383408-5383430 GCACTGGTGTTAGCATGTCCAGG - Intergenic
1169832232 20:9838112-9838134 GCACCCTTGTGAGCAGGGCGTGG - Intronic
1170093439 20:12617730-12617752 GCACCAGTGTTAGCAAGTCCAGG - Intergenic
1172776962 20:37413502-37413524 GCAGCTTTGTTCTCAGGTCCCGG - Intergenic
1176347381 21:5762057-5762079 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176354195 21:5882641-5882663 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176359393 21:5982526-5982548 GCACCAGTGTTAGTAGGTCCAGG + Intergenic
1176497446 21:7562398-7562420 GCAGCAGTGTTAACAGGTCCAGG + Intergenic
1176541702 21:8160127-8160149 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176560653 21:8343172-8343194 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176985129 21:15427153-15427175 GCACCATTGTCAGAAGGTGATGG - Intergenic
1179764125 21:43556024-43556046 GCACCAGTGTTAGTAGGTCCAGG - Intronic
1184331242 22:43829180-43829202 CCACCATCGTCACCAGGTCCTGG + Exonic
1184706765 22:46219573-46219595 ACACCATCGTTAACAGGTGCAGG - Intronic
1185060122 22:48602305-48602327 GCACACCAGTTAGCAGGTCCTGG + Intronic
1203246641 22_KI270733v1_random:76546-76568 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
952409512 3:33034527-33034549 GCACCATTGCCAGCTGCTCCTGG + Intronic
954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG + Intronic
958640026 3:96794382-96794404 GCACTAGTGTTAGCAGGTCCAGG + Intergenic
959584712 3:108015330-108015352 GCACCATTGTGGGCATGACCAGG - Intergenic
960014477 3:112871456-112871478 ACACCAATGTTAGTGGGTCCAGG + Intergenic
960551291 3:118978493-118978515 GTACCAGTGTTAGCGGGTCCAGG - Intronic
962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG + Intronic
962592612 3:136906524-136906546 GCACCAGTGTTAGCAGGTTCAGG + Intronic
963023630 3:140897384-140897406 TCACCACTGTTAGCAGGGCATGG - Intergenic
967460952 3:189744818-189744840 GTACCATTGTTAGTGAGTCCAGG - Intronic
970285746 4:14512526-14512548 GTACATTTGTTAGCAGTTCCTGG - Intergenic
974242935 4:59274620-59274642 GCTCCAATGTTAGCTGGTCTAGG - Intergenic
975917384 4:79341040-79341062 GCACCAATGTTAACCTGTCCAGG - Intergenic
978734978 4:112075587-112075609 GCCCCTTTGTTTGCAGGTCATGG - Intergenic
981282222 4:142971416-142971438 GCACAAATGTTAGGAAGTCCTGG + Intergenic
982190908 4:152854893-152854915 GCACCAGTGTTAATGGGTCCAGG + Intronic
983949826 4:173627165-173627187 GCACTGATGTTAGCAGGTCCAGG + Intergenic
988065107 5:26222471-26222493 CAACCATTCTTAGCAGTTCCTGG - Intergenic
988879539 5:35486222-35486244 GAGCCATGGTTGGCAGGTCCAGG - Intergenic
989231085 5:39086819-39086841 GCACCAGAGTCAGCAGGTCCAGG - Intergenic
989498080 5:42132273-42132295 GCACCCATGATAGCAGGTCCAGG - Intergenic
992704954 5:79381054-79381076 GCACCAGTGTTAGCAGTTCCAGG - Intronic
994688145 5:102982429-102982451 GTATCAGTGGTAGCAGGTCCAGG - Intronic
995915297 5:117238479-117238501 GCAACATTTTAAGCAGTTCCAGG + Intergenic
997782009 5:136668098-136668120 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
999964344 5:156792537-156792559 GTACCTTCGTTAGCAGTTCCTGG - Intergenic
1002868864 6:1147752-1147774 GCACCGTGGTGAGCAGGTCCTGG - Intergenic
1005798172 6:29390650-29390672 GCACCAATGTTAGCGGGTTTAGG + Intronic
1007907218 6:45473919-45473941 CCACCATGGTCACCAGGTCCTGG + Intronic
1008875505 6:56321648-56321670 GTACCTTTGTTAGCAGTTTCTGG - Intronic
1011779704 6:90773546-90773568 TCACCATTCTTAAAAGGTCCTGG - Intergenic
1013572117 6:111439317-111439339 GTACATTTGTTAGCAGTTCCTGG - Intronic
1014864998 6:126518334-126518356 GTACGTTTGTTAGCAGTTCCTGG + Intergenic
1016237677 6:141887710-141887732 GCATCATTGTTAGCTGGGCTGGG - Intergenic
1016247129 6:141995422-141995444 GCACCAGTGTTAGAGGGTGCAGG - Intergenic
1016425816 6:143934882-143934904 GCACTGGTGTTAGCAGGTCCAGG + Intronic
1016767409 6:147810461-147810483 GCACAATTGTGAGCTGGTCCTGG + Intergenic
1020617490 7:10477118-10477140 GCAACAATGTTGGCAGGTCATGG - Intergenic
1022370162 7:29763482-29763504 TAGCCATTGTTAGCAAGTCCTGG - Intergenic
1022985703 7:35651287-35651309 GCACCAGTGTGAGATGGTCCAGG - Intronic
1023232698 7:38051164-38051186 GCACCAGTGTTGGCAGGTCTAGG + Intergenic
1025067995 7:55874448-55874470 ATGCCATTGTTAGCAGATCCAGG + Intergenic
1027938256 7:84637073-84637095 GCACCATGGTTGGCATGTTCAGG + Intergenic
1030683735 7:112460785-112460807 TCACCATTGGTATCAGGCCCAGG - Intronic
1032901923 7:136320354-136320376 GCACCAGTGTTAGCAGATCCAGG + Intergenic
1035458474 7:159024436-159024458 GCACCACTGTGAGGAGGTCATGG + Intergenic
1036826044 8:11977061-11977083 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
1037812259 8:22094142-22094164 GCAACATTCTTAGCACCTCCAGG + Intronic
1038219310 8:25592522-25592544 GTACCAGTGATAGCAGATCCAGG - Intergenic
1039924095 8:41913474-41913496 GTACGTTTGTTAGCAGTTCCTGG + Intergenic
1040360474 8:46659474-46659496 ATACCATTGTTAGCAGATCCAGG - Intergenic
1044916056 8:97113567-97113589 GCAGCATAGTGAGCAGGTTCTGG + Intronic
1045337980 8:101225267-101225289 TCACCACTGTTAACAGATCCTGG - Intergenic
1046431513 8:114134676-114134698 GCACCAGTGTTAGAAAGTCTAGG + Intergenic
1048331538 8:133473999-133474021 GCACCACTGTGTGCAGGTCCTGG - Intronic
1049280247 8:141740490-141740512 GCAGCACTGTTAGGAGGGCCTGG - Intergenic
1050242942 9:3658014-3658036 TCACCAGTGTCAGCAGGTCCAGG + Intergenic
1055662693 9:78520612-78520634 GCAACAGTGTTAGCAGGTTCAGG - Intergenic
1056176958 9:84045029-84045051 GCACCATTTTTAGTGGGTCTAGG + Intergenic
1059563147 9:115354822-115354844 GTACGTTTGTTAGCAGTTCCTGG - Intronic
1203462975 Un_GL000220v1:59608-59630 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1187575066 X:20545626-20545648 GCAACATAGCTAGCAGCTCCAGG - Intergenic
1187628260 X:21141354-21141376 GCACTGATGGTAGCAGGTCCAGG + Intergenic
1188285038 X:28316210-28316232 GCACCACTGTTAGTAGGTATAGG - Intergenic
1188739694 X:33763545-33763567 GCACCATTGCTAGCAGATCCAGG + Intergenic
1188757850 X:33986908-33986930 GCACCAGTGTTAGTGGATCCAGG + Intergenic
1190925027 X:54895040-54895062 GCCCTGGTGTTAGCAGGTCCAGG - Intergenic
1191611737 X:63122532-63122554 GCAGCAGTGTTATCAGGTCTAGG - Intergenic
1192840558 X:74850421-74850443 GCAACAATGTTAGTTGGTCCTGG - Intronic
1194434043 X:93848620-93848642 GCATTGTTGTTAGCAGGTCCAGG + Intergenic
1195736637 X:108018957-108018979 GCACCACTGTTAGTGTGTCCAGG + Intergenic
1196574906 X:117305717-117305739 GCACTAGTGTTAGTGGGTCCAGG - Intergenic
1197309192 X:124883504-124883526 GCACCAGTCTTAGTGGGTCCAGG + Intronic
1197521026 X:127495905-127495927 GCACTGGTGTCAGCAGGTCCTGG - Intergenic
1197548861 X:127862479-127862501 GCACCATTGTTAGCAGGTCCAGG - Intergenic
1197643412 X:128992366-128992388 GAATCAGTGTTAGAAGGTCCAGG + Intergenic
1197710534 X:129663551-129663573 GCACCTTTGTTTGCAGAGCCAGG + Intergenic
1198299113 X:135317408-135317430 GCACCATTGTTAGCAGGTCCAGG + Intronic
1198844218 X:140892718-140892740 GCACATTCGTTAGCAGTTCCTGG - Intergenic
1200743229 Y:6877702-6877724 GCACCAATGTTACTGGGTCCTGG - Intergenic