ID: 1197553222

View in Genome Browser
Species Human (GRCh38)
Location X:127920742-127920764
Sequence TATGTATTGATACCAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197553221_1197553222 13 Left 1197553221 X:127920706-127920728 CCTTGTTTGTGTAGCTGCTTTAT No data
Right 1197553222 X:127920742-127920764 TATGTATTGATACCAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197553222 Original CRISPR TATGTATTGATACCAAAACC TGG Intergenic
No off target data available for this crispr