ID: 1197568936

View in Genome Browser
Species Human (GRCh38)
Location X:128125184-128125206
Sequence GATGATGCACAGAAAGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197568935_1197568936 12 Left 1197568935 X:128125149-128125171 CCACGTAAAAAAACATAAACAAC No data
Right 1197568936 X:128125184-128125206 GATGATGCACAGAAAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197568936 Original CRISPR GATGATGCACAGAAAGCTTT TGG Intergenic
No off target data available for this crispr