ID: 1197571025

View in Genome Browser
Species Human (GRCh38)
Location X:128150809-128150831
Sequence CTGGAGTCCTTGAATTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197571025_1197571028 21 Left 1197571025 X:128150809-128150831 CCTTCAAAATTCAAGGACTCCAG No data
Right 1197571028 X:128150853-128150875 TAACAAAATAGACCGCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197571025 Original CRISPR CTGGAGTCCTTGAATTTTGA AGG (reversed) Intergenic
No off target data available for this crispr