ID: 1197576953

View in Genome Browser
Species Human (GRCh38)
Location X:128225749-128225771
Sequence GAATTGTATTTATAACTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197576950_1197576953 29 Left 1197576950 X:128225697-128225719 CCCTTACAGGCAAGCAGTCATAT No data
Right 1197576953 X:128225749-128225771 GAATTGTATTTATAACTTCTGGG No data
1197576951_1197576953 28 Left 1197576951 X:128225698-128225720 CCTTACAGGCAAGCAGTCATATG No data
Right 1197576953 X:128225749-128225771 GAATTGTATTTATAACTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197576953 Original CRISPR GAATTGTATTTATAACTTCT GGG Intergenic
No off target data available for this crispr