ID: 1197581428

View in Genome Browser
Species Human (GRCh38)
Location X:128288615-128288637
Sequence CTATTGTACCATGACTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197581428_1197581432 30 Left 1197581428 X:128288615-128288637 CCAGCTCAGTCATGGTACAATAG No data
Right 1197581432 X:128288668-128288690 TCTAGTCCCTGACTCCCAGATGG 0: 12
1: 44
2: 85
3: 165
4: 436
1197581428_1197581430 -1 Left 1197581428 X:128288615-128288637 CCAGCTCAGTCATGGTACAATAG No data
Right 1197581430 X:128288637-128288659 GAATGCCAGGTAGATTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197581428 Original CRISPR CTATTGTACCATGACTGAGC TGG (reversed) Intergenic
No off target data available for this crispr