ID: 1197591863

View in Genome Browser
Species Human (GRCh38)
Location X:128419354-128419376
Sequence GTTATCTGCAGAAGATGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197591863_1197591869 26 Left 1197591863 X:128419354-128419376 CCCAGTCATCTTCTGCAGATAAC No data
Right 1197591869 X:128419403-128419425 AGCCTGTTACTGGGCTTTGGTGG No data
1197591863_1197591865 -5 Left 1197591863 X:128419354-128419376 CCCAGTCATCTTCTGCAGATAAC No data
Right 1197591865 X:128419372-128419394 ATAACTACTCTTCTTTTGAGAGG No data
1197591863_1197591868 23 Left 1197591863 X:128419354-128419376 CCCAGTCATCTTCTGCAGATAAC No data
Right 1197591868 X:128419400-128419422 CTTAGCCTGTTACTGGGCTTTGG 0: 9
1: 177
2: 167
3: 118
4: 218
1197591863_1197591866 16 Left 1197591863 X:128419354-128419376 CCCAGTCATCTTCTGCAGATAAC No data
Right 1197591866 X:128419393-128419415 GGCAGCTCTTAGCCTGTTACTGG No data
1197591863_1197591867 17 Left 1197591863 X:128419354-128419376 CCCAGTCATCTTCTGCAGATAAC No data
Right 1197591867 X:128419394-128419416 GCAGCTCTTAGCCTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197591863 Original CRISPR GTTATCTGCAGAAGATGACT GGG (reversed) Intergenic
No off target data available for this crispr