ID: 1197591866

View in Genome Browser
Species Human (GRCh38)
Location X:128419393-128419415
Sequence GGCAGCTCTTAGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197591864_1197591866 15 Left 1197591864 X:128419355-128419377 CCAGTCATCTTCTGCAGATAACT 0: 21
1: 199
2: 184
3: 120
4: 249
Right 1197591866 X:128419393-128419415 GGCAGCTCTTAGCCTGTTACTGG No data
1197591863_1197591866 16 Left 1197591863 X:128419354-128419376 CCCAGTCATCTTCTGCAGATAAC No data
Right 1197591866 X:128419393-128419415 GGCAGCTCTTAGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197591866 Original CRISPR GGCAGCTCTTAGCCTGTTAC TGG Intergenic
No off target data available for this crispr