ID: 1197593065

View in Genome Browser
Species Human (GRCh38)
Location X:128432674-128432696
Sequence AGGATGACTTCATATTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197593061_1197593065 1 Left 1197593061 X:128432650-128432672 CCCTTTTCTAGGGGTTAGGCATC No data
Right 1197593065 X:128432674-128432696 AGGATGACTTCATATTTCAAGGG No data
1197593062_1197593065 0 Left 1197593062 X:128432651-128432673 CCTTTTCTAGGGGTTAGGCATCA No data
Right 1197593065 X:128432674-128432696 AGGATGACTTCATATTTCAAGGG No data
1197593059_1197593065 3 Left 1197593059 X:128432648-128432670 CCCCCTTTTCTAGGGGTTAGGCA No data
Right 1197593065 X:128432674-128432696 AGGATGACTTCATATTTCAAGGG No data
1197593060_1197593065 2 Left 1197593060 X:128432649-128432671 CCCCTTTTCTAGGGGTTAGGCAT No data
Right 1197593065 X:128432674-128432696 AGGATGACTTCATATTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197593065 Original CRISPR AGGATGACTTCATATTTCAA GGG Intergenic
No off target data available for this crispr