ID: 1197593818

View in Genome Browser
Species Human (GRCh38)
Location X:128442872-128442894
Sequence GAGCAGTGGCCTTAGATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197593818_1197593822 9 Left 1197593818 X:128442872-128442894 CCTTGGATCTAAGGCCACTGCTC No data
Right 1197593822 X:128442904-128442926 TTAACTTCCAGTCAAGAGGAAGG No data
1197593818_1197593824 23 Left 1197593818 X:128442872-128442894 CCTTGGATCTAAGGCCACTGCTC No data
Right 1197593824 X:128442918-128442940 AGAGGAAGGTAGAAAATCCCAGG No data
1197593818_1197593825 24 Left 1197593818 X:128442872-128442894 CCTTGGATCTAAGGCCACTGCTC No data
Right 1197593825 X:128442919-128442941 GAGGAAGGTAGAAAATCCCAGGG No data
1197593818_1197593821 5 Left 1197593818 X:128442872-128442894 CCTTGGATCTAAGGCCACTGCTC No data
Right 1197593821 X:128442900-128442922 CTCATTAACTTCCAGTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197593818 Original CRISPR GAGCAGTGGCCTTAGATCCA AGG (reversed) Intergenic
No off target data available for this crispr