ID: 1197593822

View in Genome Browser
Species Human (GRCh38)
Location X:128442904-128442926
Sequence TTAACTTCCAGTCAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197593818_1197593822 9 Left 1197593818 X:128442872-128442894 CCTTGGATCTAAGGCCACTGCTC No data
Right 1197593822 X:128442904-128442926 TTAACTTCCAGTCAAGAGGAAGG No data
1197593819_1197593822 -5 Left 1197593819 X:128442886-128442908 CCACTGCTCCAGTTCTCATTAAC No data
Right 1197593822 X:128442904-128442926 TTAACTTCCAGTCAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197593822 Original CRISPR TTAACTTCCAGTCAAGAGGA AGG Intergenic
No off target data available for this crispr