ID: 1197593824

View in Genome Browser
Species Human (GRCh38)
Location X:128442918-128442940
Sequence AGAGGAAGGTAGAAAATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197593820_1197593824 1 Left 1197593820 X:128442894-128442916 CCAGTTCTCATTAACTTCCAGTC No data
Right 1197593824 X:128442918-128442940 AGAGGAAGGTAGAAAATCCCAGG No data
1197593819_1197593824 9 Left 1197593819 X:128442886-128442908 CCACTGCTCCAGTTCTCATTAAC No data
Right 1197593824 X:128442918-128442940 AGAGGAAGGTAGAAAATCCCAGG No data
1197593818_1197593824 23 Left 1197593818 X:128442872-128442894 CCTTGGATCTAAGGCCACTGCTC No data
Right 1197593824 X:128442918-128442940 AGAGGAAGGTAGAAAATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197593824 Original CRISPR AGAGGAAGGTAGAAAATCCC AGG Intergenic