ID: 1197593825

View in Genome Browser
Species Human (GRCh38)
Location X:128442919-128442941
Sequence GAGGAAGGTAGAAAATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197593819_1197593825 10 Left 1197593819 X:128442886-128442908 CCACTGCTCCAGTTCTCATTAAC No data
Right 1197593825 X:128442919-128442941 GAGGAAGGTAGAAAATCCCAGGG No data
1197593820_1197593825 2 Left 1197593820 X:128442894-128442916 CCAGTTCTCATTAACTTCCAGTC No data
Right 1197593825 X:128442919-128442941 GAGGAAGGTAGAAAATCCCAGGG No data
1197593818_1197593825 24 Left 1197593818 X:128442872-128442894 CCTTGGATCTAAGGCCACTGCTC No data
Right 1197593825 X:128442919-128442941 GAGGAAGGTAGAAAATCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197593825 Original CRISPR GAGGAAGGTAGAAAATCCCA GGG Intergenic
No off target data available for this crispr